KCI등재
SCIE
SCOPUS
Prevalence of Seasonal Influenza Viruses and Pandemic H1N1 Virus in Beijing from 2008 to 2012
저자
Shujuan Cui (Beijing Center for Disease Prevention and Control, Beijing) ; Lili Tian (Institute for Infectious Disease and Endemic Disease Control, Beijing Center for Disease Prevention) ; Xiaomin Peng (Institute for Infectious Disease and Endemic Disease Control, Beijing Center for Disease Prevention) ; Guilan Lu (Institute for Infectious Disease and Endemic Disease Control, Beijing Center for Disease Prevention) ; Weixian Shi (Institute for Infectious Disease and Endemic Disease Control, Beijing Center for Disease Prevention) ; Dongmei Meng (Department of Pharmaceutical Engineering, Heze University, Shandong, China) ; Quanyi Wang (Institute for Infectious Disease and Endemic Disease Control, Beijing Center for Disease Prevention)
발행기관
학술지명
Annals of Laboratory Medicine(Annals of Laboratory Medicine)
권호사항
발행연도
2012
작성언어
English
등재정보
KCI등재,SCIE,SCOPUS
자료형태
학술저널
발행기관 URL
수록면
455-456(2쪽)
KCI 피인용횟수
3
제공처
소장기관
In northern China, influenza circulates on a seasonal and regular basis during the winter-spring season [1]. Our study was conducted in Beijing between November 2008 and March 2012, specifically from November 2008 to March 2009 (period 1), from November 2009 to March 2010 (period 2), from November 2010 to March 2011 (period 3), and from November 2011 to March 2012 (period 4), in order to evaluate the annual incidence rates of influenza and to identify the circulating viral types and subtypes for facilitating the local vaccination programs and regional influenza control. Virological prevalence, the subject of the surveillance, was defined based on the influenza-like illnesses (ILIs) as follows: a temperature of ≥38˚C, either cough or sore throat, and no laboratory- confirmed evidence of another disease in patients who presented at the Fever Outpatient Clinic Department of the sentinel hospitals. Over the 4 yr, 6,397 throat swab samples from outpatients with ILIs were collected and tested. The ages of outpatients ranged between 6 months and 91 yr (median, 32 yr; mean, 37.1 yr). Specimens were collected from both female (n=3,338; 52.18%) and male (n=3,059; 47.82%) patients. Total RNA was extracted from 100 μL of each sample using QIAmp Viral RNA Mini kit (QIAGEN, Valencia, CA, USA); subsequently, they were analyzed by real-time (RT) PCR methods for influenza viruses, as recommended by the Chinese National Influenza Center, including seasonal influenza viruses such as FluA(H1N1), FluA(H3N2), FluB, and pdmH1N1 under the same testing conditions and procedures with the exception of the respective primers and probe, i.e., FluA(H1N1)-F, AACATGTTACCCAGGGCATTTCGC; FluA(H1N1)-R, GTGGTTGGGCCATGAGCTTTCTTT; FluA(H1N1)-P, GAGGAACTGAGGGAGCAATTGAGTTCAG; FluA (H3N2)-F, ACCCTCAGTGTGATGGCTTCCAAA; FluA(H3N2)-R, TAAGGGAGGCATAATCCGGCACAT; FluA(H3N2)-P, ACGCAGCAAAGCCTACAGCAACTGT; FluB-F, TCCTCAACTCACTCTTCGAGCG; FluB-R, CGGTGCTCTTGACCAAATTGG; FluB-P, CCAATTCGAGCAGCTGAAACTGCGGTG; pdmH1N1-F, GGGTAGCCCCATTGCAT; pdmH1N1-R, AGAGTGATTCACACTCTGGATTTC;and pdmH1N1-P, TGGGTAAATGTAACATTGCTGGCTGG. Real-time (RT) PCR was performed using AgPath-IDTM One-Step RT-PCR Kit (Applied Biosystems International, Foster City, CA, USA) with an ABI Prism 7500 Taqman machine (Applied Biosystems International). The reaction was conducted at a total volume of 25 μL containing 12.5 μL of 2×RT-PCR buffer, 1 μL of 2×RT-PCR enzyme, 1.67 μL of detection enhancer, 400 nM of each primer, 200 nM of probe, 3.33 μL of double distilled water (ddH2O), and 5 μL of template. Optimized amplification conditions were as follows: 1 cycle of 50˚C for 30 min, followed by 10 min at 95˚C, and 45 cycles of 15 sec at 95˚C and 45 sec at 55˚C. Influenza viruses were detected in 6,397 clinical samples of outpatients with ILIs at peak times, with varying compositions of influenza numbers. Fluctuating trends were observed in Beijing, China, over the 4 continuous periods. The results of prevalence of common seasonal influenza are summarized in Fig. 1. From period 1 to period 4, the positive prevalence rate of FluA(H1N1) decreased sharply year by year (period 1, 8.12%; period 2, 2.9%; period 3, 0.32%; and period 4, 0%), especially for period 4, where no positive case of FluA(H1N1) was recorded. Conversely, pdmH1N1 gradually replaced FluA(H1N1) from the start of the 2009 epidemics (period 1, 0%; period 2, 25.64%; period 3, 10.71%; and period 4, 4.65%). FluA(H3N2) and FluB also present fluctuating changes in the positive detection rate of the surveillance;they are the predominant viral members of seasonal influenza due to the principle of dominance by competitive circulation, whereby 1 type or subtype of seasonal influenza virus becomes the predominant form while the other types and subtypes of seasonal influenza virus play a secondary role. The predominant positive detection rates over the 4 periods were: FluA(H3N2), 10.88%; pdmH1N1, 25.64%; FluA(H3N2), 12.39%; and FluB, 15.37%. Especially in...
더보기분석정보
연월일 | 이력구분 | 이력상세 | 등재구분 |
---|---|---|---|
2023 | 평가예정 | 해외DB학술지평가 신청대상 (해외등재 학술지 평가) | |
2020-01-01 | 평가 | 등재학술지 유지 (해외등재 학술지 평가) | KCI등재 |
2012-05-21 | 학술지명변경 | 한글명 : The Korean Journal of Laboratory Medicine -> Annals of Laboratory Medicine외국어명 : The Korean Journal of Laboratory Medicine -> Annals of Laboratory Medicine | KCI등재 |
2011-01-01 | 평가 | 학술지 분리 (기타) | KCI등재 |
2010-06-29 | 학술지명변경 | 한글명 : 대한진단검사의학회지 -> The Korean Journal of Laboratory Medicine | KCI등재 |
2009-01-01 | 평가 | 등재학술지 유지 (등재유지) | KCI등재 |
2007-01-01 | 평가 | 등재학술지 유지 (등재유지) | KCI등재 |
2005-01-01 | 평가 | 등재학술지 유지 (등재유지) | KCI등재 |
2002-01-01 | 평가 | 등재학술지 선정 (등재후보2차) | KCI등재 |
1999-07-01 | 평가 | 등재후보학술지 선정 (신규평가) | KCI후보 |
기준연도 | WOS-KCI 통합IF(2년) | KCIF(2년) | KCIF(3년) |
---|---|---|---|
2016 | 1.51 | 0.18 | 1.15 |
KCIF(4년) | KCIF(5년) | 중심성지수(3년) | 즉시성지수 |
0.91 | 0.81 | 0.458 | 0.08 |
서지정보 내보내기(Export)
닫기소장기관 정보
닫기권호소장정보
닫기오류접수
닫기오류 접수 확인
닫기음성서비스 신청
닫기음성서비스 신청 확인
닫기이용약관
닫기학술연구정보서비스 이용약관 (2017년 1월 1일 ~ 현재 적용)
학술연구정보서비스(이하 RISS)는 정보주체의 자유와 권리 보호를 위해 「개인정보 보호법」 및 관계 법령이 정한 바를 준수하여, 적법하게 개인정보를 처리하고 안전하게 관리하고 있습니다. 이에 「개인정보 보호법」 제30조에 따라 정보주체에게 개인정보 처리에 관한 절차 및 기준을 안내하고, 이와 관련한 고충을 신속하고 원활하게 처리할 수 있도록 하기 위하여 다음과 같이 개인정보 처리방침을 수립·공개합니다.
주요 개인정보 처리 표시(라벨링)
목 차
3년
또는 회원탈퇴시까지5년
(「전자상거래 등에서의 소비자보호에 관한3년
(「전자상거래 등에서의 소비자보호에 관한2년
이상(개인정보보호위원회 : 개인정보의 안전성 확보조치 기준)개인정보파일의 명칭 | 운영근거 / 처리목적 | 개인정보파일에 기록되는 개인정보의 항목 | 보유기간 | |
---|---|---|---|---|
학술연구정보서비스 이용자 가입정보 파일 | 한국교육학술정보원법 | 필수 | ID, 비밀번호, 성명, 생년월일, 신분(직업구분), 이메일, 소속분야, 웹진메일 수신동의 여부 | 3년 또는 탈퇴시 |
선택 | 소속기관명, 소속도서관명, 학과/부서명, 학번/직원번호, 휴대전화, 주소 |
구분 | 담당자 | 연락처 |
---|---|---|
KERIS 개인정보 보호책임자 | 정보보호본부 김태우 | - 이메일 : lsy@keris.or.kr - 전화번호 : 053-714-0439 - 팩스번호 : 053-714-0195 |
KERIS 개인정보 보호담당자 | 개인정보보호부 이상엽 | |
RISS 개인정보 보호책임자 | 대학학술본부 장금연 | - 이메일 : giltizen@keris.or.kr - 전화번호 : 053-714-0149 - 팩스번호 : 053-714-0194 |
RISS 개인정보 보호담당자 | 학술진흥부 길원진 |
자동로그아웃 안내
닫기인증오류 안내
닫기귀하께서는 휴면계정 전환 후 1년동안 회원정보 수집 및 이용에 대한
재동의를 하지 않으신 관계로 개인정보가 삭제되었습니다.
(참조 : RISS 이용약관 및 개인정보처리방침)
신규회원으로 가입하여 이용 부탁 드리며, 추가 문의는 고객센터로 연락 바랍니다.
- 기존 아이디 재사용 불가
휴면계정 안내
RISS는 [표준개인정보 보호지침]에 따라 2년을 주기로 개인정보 수집·이용에 관하여 (재)동의를 받고 있으며, (재)동의를 하지 않을 경우, 휴면계정으로 전환됩니다.
(※ 휴면계정은 원문이용 및 복사/대출 서비스를 이용할 수 없습니다.)
휴면계정으로 전환된 후 1년간 회원정보 수집·이용에 대한 재동의를 하지 않을 경우, RISS에서 자동탈퇴 및 개인정보가 삭제처리 됩니다.
고객센터 1599-3122
ARS번호+1번(회원가입 및 정보수정)